Skip to content

FischDB - die Fischdatenbank

Personal tools
You are here: Home » Fischkatalog » Dentex dentex » dna
Views
  • State: published

Dentex dentex – DNA-Sequenzen

Gen: Cytochrome b, mitochondrial,

Primer
H 15149 ad GCI CTT CAR AAT GAY AAT TGT CCT CA
L 14735 AAA AAC CAC CGT TGT TAT TCA ACT A

Sequenz:
>AF143197
atggcaagcc tccggaaaac ccacccacta ctaaaaattg ctaaccacgc agtagttgacctacctgcac
cctctaatat ttctgtctga tgaaattttg gctccctgct cggcctctgc ttaatttctc aaatcctcac
aggactgttc cttgctatgc attacacctc ggacattgct acagcctttt cttctgtcgc ccatatttgt
cgagacgtaa actacggctg acttatccgc aatctccatg ctaatggagc atcttttttc ttcatctgca
tttaccttca catcggacga ggcctctact atggctccta cctctacaaa gaaacatgaa acattggcgt
tatccttctt cttcttgtaa tagcaacagc cttcgtaggc tacgttctcc catgaggaca aatatcattc
tgaggagc
Referenz: National Center of Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov/)