Skip to content

FischDB - die Fischdatenbank

Personal tools
You are here: Home » Fischkatalog » Dicologoglossa hexophthalma » dna
Views
  • State: published

Dicologoglossa hexophthalma – DNA-Sequenzen

Gen: Cytochrome b, mitochondrial,

Primer
H 15149 ad GCI CTT CAR AAT GAY AAT TGT CCT CA
L 14735 AAA AAC CAC CGT TGT TAT TCA ACT A

Sequenz:
CAAGAACACAATGGCCAGCCTCCGAAAATCCCACCCCTTAATTAAAATCGTTAACAGCTC
TGTAATTGACCTCCCCGCTCCCTCTAATATTTCTGCCTGATGAAACTTCGGCTCACTCCT
GGGCCTTTGCCTTGGTACTCAAATCGTCACAGGCCTACTACTTGCCATACACTACACAGC
AGATGCCGCCACCGCATTCTCATCCGTTGTTCACATCTGCCAAGATGTAAACTACGGGTG
ACTAATCCGAAATGTTCACGCCAACGGAGCATCACTTTTTTTTATCTGTATTTATCTTCA
CATCGGTCGAGGCCTATACTATGGCTCTTACACCAATAAAGAAACCTGAAACATCGGAGT
CGTACTACTTCTCCTAGTCATAGCAACCGCCTTCCTAGGTCTATCTT
Referenz: BFEL Fischqualität Ko